Научный журнал
Успехи современного естествознания
ISSN 1681-7494
"Перечень" ВАК
ИФ РИНЦ = 0,791

РАСПРОСТРАНЕНИЕ ПОЛИМОРФИЗМА ИНТЕРЛЕЙКИНА – 8 – 251 ТА СРЕДИ ЖЕНЩИН АЗЕРБАЙДЖАНА БОЛЬНЫМИ ЭНДОМЕТРИОЗОМ

Рзаева А.Ш.
Впервые было изучено интерлейкина – 8 – 251 ТА среди женщин Азербайджана больными эндометриозом. 50 практически здоровых и 70 женщин больных эндомертиозом находились под нашем наблюдением. Исследование показали что, генетический полиморизм интерлейкина – 8 А/Т 251 играет роль в потогенезе эндометриоза.
эндометриоз
интерлейкина – 8
генетический полиморизм

Эндометриоз дисгормоналное, иммунозависимое и генетически обусловленное заболевания с доброкачественным разрастанием ткани, сходной по морфологическому строению и функции с эндометрием, но находящейся за пределами матки [1].

Больные с различными формами этой патологии страдают стойким болевым синдромом, нарушениями менструального цикла, дисфункциональными маточными кровотечениями и подвергаются многократным лечебно - диагностическим выскабливанием матки, оперативным вмешательствам, нередко бесполезным терапевтическим воздействием. [3]

Тазовая боль и вегетативно-сосудистые нарушения заставляют этих женщин обращаться ко многим специалистам, в том числе к психиатрам и психоневрологам.

Частота заболевания у женщин репродуктивного возраста, по данным различных авторов варьирует от 7 до 50 %, причем в последние годы отмечается неуклонный рост данной патологии [9, 10, 11]. Установлено что 30-40 % больных эндометриозом страдают бесплодием и невынашиванием беременности. Не менее чем у 78 % больных, получивших медикаментозную терапию по поводу эндометриоза отмечается персистенция заболевания и его рецидивы. [2]

Не смотря на значительное увеличение числа научных и клинических исследований, посвященных различным аспектам эндометриоза, многие вопросы его этиопатогенеза, диагностики, течение и терапии остаются спорными.

В настоящее время считается доказанным, что выживание и имплантация жизнеспособных фрагментов эндометрия в перитонеальной поверхности обусловлены нарушениям локального иммунного ответа.

У женщин страдающих эндометриозом увеличено содержание перитонеалных макрофагов, усилена их активность и секреция ими различных цитокинов. В последние годы было доказано что в организме женщин больных эндометриозом повышается содержание провоспалительного цитокина интерлейкина - 8 [4, 5, 6,].

Выявлено что за продукцию ИЛ-8 отвечает 13q-21q регион 4-й хромосомы. Генетический полиморфизм ТА в - 251 участке повышает продукцию ИЛ-8 [7, 8].

В Азербайджанской популяции изучению генетической зависимости эндометриоза способствует этническая однородность популяции, высокая частота данного заболевания среди женщин репродуктивного возраста, в связи с чем значительный научный интерес представляют исследования по изучению полиморфизма гена отвечающего за экспрессию интерлейкина - 8.

Целю нашего исследования разработать методы прогнозирования и ранней диагностики эндометриоза по данным полиморфизмов гена ИЛ-8 среди женщин Азербайджанской популяции.

Материалы и методы исследования

Под нашим наблюдением находилась 70 больных страдающих эндометриозом. Диагноз быль подтвержден после операционного вмешательство. Больные были в возрасте от 15 до 56 лет. Длительность заболевания колебалось от нескольких месяцев до 6 лет.

Наряду с общеклиническим обследованием больным было проведено комплексное инструментальное исследование с использованием гистероскопии, гистеросальпингографии, эхографии. Также у всех больных было проведено генетическая тестирование на определения полиморфизма ИЛ-8-251 - АТ.

Контрольную группу составили 50 практически здоровых женщин.

Для выявления полиморфизма ИЛ-8-251-ТА было использовано метод PCR-ARMS.

Участок для амплификации быль выбран на основании материалов предоставленных NCBİ SNP под номером rs4073:

F1, 5′ - GTTATCTAGAAATAAAAAAGCATACAA - 3′;

R1, 5′ - CTCATCTTTTCATTATGTCAGAG - 3′;

F2, 5′ - CATGATAGCATCTGTAATTAACTG - 3′;

R2, 5′ - CACAATTTGGTGAATTATCAA - 3′.

Для проведения реакции были использованы следующие реагенты:

DNT-5μl; Buffer 2,5μ; MgCl2-1,75μl; dNTP-0,5μl, из каждого примера 10 pmol; Taq A - 0,2μl.

Реакция PCR было проведено по следующему протоколу:

94 ºC - 5 мин - 1 цикл, 94 ºC - 30 мин, 54 ºC - 30 с, 72 ºC - 30 с, 35 цикл и 72 ºC - 7 мин - 1 цикл.

Полученные материалы были визуализированы после электрофореза в 2 % - ном агорозном геле.

Результаты исследования

Генотипы по полиморфизму ИЛ-8 ТА представлен в табл. 1.

У женщин с эндометриозом генотип ТТ составила 41,4 %. В контрольной группе генотип АА составило 50 % в то время как этот генотип в основной группе составило 21,4 %.

Таблица 1

Распостраненность генотипов ИЛ-8 ТА среди практически здоровых женщин
и больных эндометриозом 

Генотипы

Контроль (n = 50)

Эндометриоз (n = 70)

TT

7 (14 %)

29 (41,4 %)

TA

18 (36 %)

26 (37,2 %)

AA

25 (50 %)

15 (21,4 %)

Популяция было в пределах равновесия по закону Харди - Вайнберга. p > 0,05

Также эти группы отличались друг от друга по аллелным показателям.

Так как, у женщин страдающих эндометриозом частота алела Т составило 60 %. Этот показатель был выше, чем в контрольной группе. В контрольной группе частота аллела А составило 68 % в то время как частота алела Т было всего 32 %.

Нами было выявлено связь между генотипом Т/Т и эндометриозом. Частота генотипа Т/Т у женщин страдающих эндометриозом было в два раза выше чем в контрольной группе.

Генетическое тестирования женщин повышенного риска развитие эндометриоза представляет важный как теоретический, так и практический интерес. Выявления полиморфизма гена ИЛ-8 позволит на доклиническом этапе определить возможный риск развитие эндометриоза и заблаговременно начать индивидуальную профилактику этого заболевания.

Таблица 2

Частота аллелов по полиморфизму ИЛ-8 - 251 АТ среди женщин
с эндометриозом и в контрольной группе 

Аллели

Контроль (n = 100)

Эндометриоз (n = 140)

T

32 (32 %)

84 (60 %)

A

68 (68 %)

56 (40 %)

 Список литературы

  1. Кулаков В.И., Андреева Е.Н. Эндометриозы. - М.: Медицина, 2006. - 410 с.
  2. Поморцев А.В., Гудков В.Г., Дегтярев А.М. Гормональный профиль больных наружным генитальным эндометриозом в различные фазы менструального цикла // Акуш. и гин. - 2002. - №1 - С. 35-42.
  3. Сидорова И.С., Коган К.А. Новый взгляд на природу эндометриоза // Акуш. и гин. - 2002. - № 3. - С. 32-37.
  4. Halme J., Becker S., Haskill S. Altered maturation and functional of peritoneal macrophages: possible role in pathogenesis of endometriosis // J. Obstet.Gynecol. - 1987. - P. 783-789.
  5. Hill J. A. et al. Effects of soluble products of activated macrophages on human sperm motion parameters // J. Fertil. Steril. - 1987. - №47. - P. 460-465.
  6. Halme J. Release of tumor necrosis fector by human peritoneal macrophages in vivo and in vitro // J. Obst. And Gynecol. - 1989. -№161. - P. 1718-1725.
  7. Hull J. Thomson A, Kviatkovski D. Assocation of respiratory syncytial virus bronchiolitis with the interleukin 8 gene region in UK families // J. Thorax. - 2000. - v. 55. - P. 1023-1027.
  8. Junko Fujihara, kuninori Shiwaku, Toshihiro Yasuda et all. Variation of interleukin -8 - 251 AT polymorphism in worldwide populations and intra-ethnic differences in Japanese populations. // Clinica Chimica Acta 337. - 2007. - P. 79-82.
  9. Karen Kinkel, Kathrin A. Frei. Diagnosis of endometriosis with imaging: a review. Eur. Radiol. - 2006. internet.
  10. Schindler A.E. Pathophysiology, diaqnosis and treatment of endometriosis // Minevra Ginecol. - P. 419-435.
  11. Vigano P, Parazzini F, Somigliana E. // Endometriosis: epidemiology and aetiological factors // J. Obstet. And Gynaecol. - 2004. - №18. - P. 177-200.

Библиографическая ссылка

Рзаева А.Ш. РАСПРОСТРАНЕНИЕ ПОЛИМОРФИЗМА ИНТЕРЛЕЙКИНА – 8 – 251 ТА СРЕДИ ЖЕНЩИН АЗЕРБАЙДЖАНА БОЛЬНЫМИ ЭНДОМЕТРИОЗОМ // Успехи современного естествознания. – 2011. – № 3. – С. 32-34;
URL: https://natural-sciences.ru/ru/article/view?id=15955 (дата обращения: 24.10.2021).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074